Thursday, March 29, 2007

What day is it? Where are we?


When I don't have an exact work schedule, I tend to get my days mixed up. Although I tend to work every other weekend, I don't work the same days during the week. I worked Tuesday 7am - 7pm and it totally felt like a Sunday to me.. so on Wednesday (yesterday), I thought it was Monday. I knew it wasn't Monday, but I had it in my head all day long that it was.
Yesterday (my day off), I spent 8 hours at work for mandatory neonatal resuscitation. CPR on a newborn (full or preterm) isn't like cpr on an infant/child or adult. I had just renewed my life support certification a few weeks ago, so those numbers were stuck in my head (the numbers have changed for those of you that don't know, along with a few other cpr changes) so with those numbers stuck in my head, it was a little difficult to remember a whole new set of numbers and sequences when dealing with a newborn. It's probably a good thing this class was 8 hours because it took just about that long for things to sink in with me. Now comes the actual resuscitations and written testing. If I didn't hear anything else during those 8 hours, I did hear "everyone passes". Maybe they shouldn't tell you that, because you may be less likely to pay attention and not allow yourself to daydream the hours away.


I also heard this; "the physician or nurse practitioner will insert the umbilical catheter into the umbilical vein with a large bore needle for medications (epinephrine) and volumes (fluids)" ... sounds good to me. I can concentrate on positive pressure ventilations, gas exchanges, oral intubations and chest compressions while someone else puts in an umbilical catheter... cool deal. I had finished my written test (100 questions) and proceeded to enter the room where six stations were set up, fully loaded with infants and all the materials needed for neonatal resuscitation... I took a seat and watched until there was an area available for me to "perform". I watched a few instructors put their student in a situation where they needed to resuscitate their newborn (not all situations were the same) and after watching them for awhile, I knew exactly which two instructors I wanted... E.Z. I hadn't paid much attention to the instructor to my left, I just knew the "student" had been with her for awhile. Two other scenarios had come and gone to the right of me, while this one student continued with her instructor to the left.


I heard "next". It was coming from the left. I looked her way and smiled, while pointing in the direction of the instructors to my right, basically saying "no thanks, I'm waiting for this station" with my facial expression.

So she said "I'm ready, come on over".

Well what am I going to do now? DEMAND that she get someone else?

I should have.

Not only did she think of the worst possible situation that a newborn could get in to, she gave me an extremely premature newborn with every problem known to man ... just when I thought I was finished resuscitating this poor baby (full intubations, ventilations, chest compressions and I even gave it some epinephrine down it's endotracheal tube AFTER I inserted an orogastric airway into it's stomach to relieve some of the air pressure), she then stated this baby needed volume and additional epinephrine! What the...

So the part during instruction about umbilical catheters was a blur only because she said a PHYSICIAN would be inserting it, I suddenly had to do. I figured how hard could this be.. there are only 3 vessels in an umbilical cord (2 arteries and 1 vein) ALTHOUGH some babies only have 1 artery and 1 vein. I knew the vein would be bigger than the 2 arteries so I catheterized it, while she cocked her head to see what I was doing... then she's like "ok how much epinephrine?" and "this baby is 3 lbs, so how much volume will we give due to blood loss, or if you prefer not to give lactated ringers, what else might you give the baby?"




Crap.


Me: "I could give it O negative packed red blood cells"
(where in the hell did that come from?)

Her: "that's right"

Her: "and what else could you give through this umbilical IV that you wouldn't give through the the endotracheal intubation tube?"

Me: "sodium bicarbonate?"

Her: "exactly"

My brain retained things that I wasn't really paying attention to after all!! I spent half the time (instruction portion) watching hot guy 3 tables over try to open a bag of Lays potato chips quietly... it took him well over half an hour to finally get the entire top of the bag open far enough to reach his hand into. (the girls at my table were enjoying this entertainment) and then we continued to watch him shift in his seat.... almost doze off... text something with his cell phone.. stuff like that.

So that was most of the day yesterday. Oh, they also had it so cold in those rooms that we were actually shivering. I drank 3 cups of hot cocoa.. put on a sweater AND thought constantly about going home and getting into a super hot bath. It was a beautiful scene to finally leave there and open the doors to the 83 degrees outside. I instantly felt better.

Monday, March 26, 2007

Dancing with the Stars

Heather Mills continues to amaze me...
I have to say, I never knew who she was until she married
Paul McCartney. Even after that, I really didn't know who she was.
After her split from Paul, the things he's said about her.. and her negative
publicity, I was surprised to see she signed up to do this in between a
nasty divorce. I can't believe I was actually influenced (a little)
by this publicity. I really like this girl. Dancing with the Stars shows clips of their dancers and you get to know them a little... She did great last week and
amazing this week dancing the Mambo.
You go, Heather!!

Friday, March 23, 2007

About me....



Click on "read my visual DNA" to find out more about me.

Monday, March 19, 2007

Which model do you like best?


... of kitchens that is? Ella gave me an idea from one of the comments she made on a previous "kitchen" post. These are the kitchens from the model homes in the community. I LOVE going through model homes, sometimes because I'm actually looking for a house, but mostly for decorating ideas and just for the fun of it. I want you to choose the best kitchen and the worst kitchen. Everyone has different taste (that's what makes us unique), so it'd be interesting to see which ones you like/dislike. A couple of the kitchens have 2 views. Now that I think about it, I should have provided 2 views of each kitchen. Maybe I'll take more pics tomorrow, haha.
Number 6 is the one I have / live in. I like 3 and 4 the best. I love a nice, open kitchen.


1

2

3

4

5


6


7

8

9

For the Ladies: "Mario Diamont"




Super Mario

I had a dream lastnight. Or was it this morning? Maybe it was at 7:00 this morning, because it was extremely fresh on my mind when I woke up. Either way, I was dating Mario Lopez. Or was it Don Diamont? I'm really not sure which one it was (but I'll take either one actually). I'll name him Mario Diamont, since I'm not sure who he was.



I don't remember too many details. I just know that I was happy. I know that we were having fun. I know that at some point we were in a bookstore and then had lunch. I also know at some point we were naked. Maybe we were at Barnes & Noble reading Dr. Phil books in the nude?



The alarm or something else woke me up and I had to take the kids to school. Damn it for being Monday and school being back in session. I want back in that dream A. S. A. P.

Maybe if I want it bad enough, I'll have the same dream tonight. Yay.

For a SWEET pic of Don Diamont, click here (or see below)

I'm going to take a nap now, ... see ya :-)
.

(Most of you wouldn't know who Don Diamont was unlessyou watched The Young & The Restless) I had a MAD crushon Don "Brad Carlton" Diamont, since 1985. :-)

Thursday, March 15, 2007

One room at a time..


out with the old...


in with the new... (cell phone pic)


this is about how much I have done with the new house... it certainly looks lived in, right? cereal boxes on the counter, cereal bowl left out. Dishes in the sink. BUT I did get my giraffes where I wanted them. (see top of cabinets). My previous house was bigger, so it's not easy finding a spot for things in this house (1950 sq ft). My giraffes and stuff were in the living room of the last place, because it had built in shelving, where this place does not. I took this pic with my cell phone. There was no way to get the entire kitchen in on one cell phone pic, there is another entire half, maybe I'll add another cell phone pic of the other side. You don't want to see the master bath... well maybe you do. I'll take a pic before I actually put things away. One room at a time!

Okay, I just had a thought.. before and after pics! So here is the kitchen before.

and the cell phone pic is after.... I.. uh, cluttered it up with stuff.

Don't make fun of me for putting giraffes in my kitchen!

Only in Japan......

This is brought to you compliments of James. If they tried this stuff in the US, there would be lawsuits galore! Watch until the end (if you can), nothing like going sledding naked. I think?

Wednesday, March 14, 2007

I have questions. Do you have answers?

Can you cry under water?

How important does a person have to be before they are considered assassinated instead of just murdered?

Why do you have to "put your two cents in"... but it's only a "penny for your thoughts"? Where's that extra penny going to?

Once you're in heaven, do you get stuck wearing the clothes you were buried in for eternity?

Why does a round pizza come in a square box?

What disease did cured ham actually have?

How is it that we put man on the moon before we figured out it would be a good idea to put wheels on luggage?

Why is it that people say they "slept like a baby" when babies wake up like every two hours?

If a deaf person has to go to court, is it still called a hearing?

Why are you IN a movie, but you're ON TV?

Why do people pay to go up tall buildings and then put money in binoculars to look at things on the ground?

Why do doctors leave the room while you change? They're going to see you naked anyway.

Why is "bra" singular and "panties" plural?

Why do toasters always have a setting that burns the toast to a horrible crisp, which no decent human being would eat?

If Jimmy cracks corn and no one cares, why is there a stupid song about him?

Can a hearse carrying a corpse drive in the carpool lane?

If the professor on Gilligan's Island can make a radio out of a coconut, why can't he fix a hole in a boat?

Why does Goofy stand erect while Pluto remains on all fours? They're both dogs!

If corn oil is made from corn, and vegetable oil is made from vegetables, what is baby oil made from?

If electricity comes from electrons, does morality come from morons?

Do the Alphabet song and Twinkle, Twinkle Little Star have the same tune?

Why did you just try singing the two songs above?

Why do they call it an asteroid when it's outside the hemisphere, but call it a hemorrhoid when it's in your butt?

Did you ever notice that when you blow in a dog's face, he gets mad at you, but when you take him for a car ride; he sticks his head out the window?

Do you ever wonder why you gave me your e-mail address in the first place?

Decode the DNA

Here is a message for you, from me. It's written in DNA coding. Will you be able to decipher this? This might help.


AGAATGGCATAAGTCGTTATGTAGCGTGGAGTTCTTCTGATGGTTGGCATGGTTGTATCAATGGTTGAGGATGTCATGCTGGGACGTATGCTCGGCCTGCTTATGGACCTTGGACTTGTACGTGTTGGCGTAATGGTTGGCATGGTCCTTCTTATGTAGGAGCGTGTTATGGATGTTATGGCGGGCGGCGCCGTCATGGCGGATGCCCTTATGCGTGAAGTTCTTGTAATGAGAATGGTTTCAGGGCTTATGGATGGAATGGCTTCAATGGCTCTTGTCGTCCGTGACCTTGTGATGATGCCAGAGGATGTCATGGTCGAGGGCTAAGCGCTGATGCTACTTATGGATGGAGTTCTTGTACTTGTCGTTGATGGAGACGTGATGATGACTCGTGGGGGGTCAATGACTTAAGCTGGGATGAATCGTTCA

Tuesday, March 13, 2007

Taking a break...

from moving....
I went here last Thursday....
to see my Derek Jeter... I mean, The Yankees

Johnny Damon at bat.. Jeter next in the lineup


laaaaydeeeeeees.... one good reason to sit on 1st base...
great shots of short stops ... :-)

shwing....

close up of DJ on 1st base


Derek, Jason, Johnny and someone else
(would have been nice to be sitting where those big boys were sitting
behind the Yankee dugout)....next year.
top of the fifth 2-2

bye bye Wide World of Sports... until next year


Take me out to the ball game,

Take me out with the crowd.

Buy me some peanuts and Cracker Jacks

I don't care if I never get back

Let me root, root, root for the home team

If they don't win it's a shame

For it's one, two, three strikes, you're out,

At the old ball game

Monday, March 05, 2007

Four things....

a Monday Meme borrowed from Cindy's World....










Four jobs that I've had:
1. GD Ritzys ice cream girl
2. waitress at Pizza Hut
3. waitress at hotel restaurant
4. Nurse





Four movies that I watch over and over
1. Shawshank Redemption
2. How to lose a guy in 10 days
3. The Breakfast Club (years ago)
4. The Notebook









Four places that I have lived:
1. Long Beach, CA
2. Biloxi, MS
3. Tuxedo, NY
4. Washington, DC











Four tv shows that I love to watch:
1. The Amazing Race
2. Wife Swap
3. Boston Legal
4. Grey's Anatomy











Four things I love to eat:
1. Shrimp
2. Shredded wheat
3. donuts
4. Lobster







Four places I'd rather be than here:
1. Yankee Stadium
2. Tuscany, Italy
3. On a beach in Cancun
4. On a cruise with Cindy. Yay.








Friday, March 02, 2007

Nonsense.


Just so that it's not an entire week since my last post (if you could call that a post), I'm going to randomly type and see what comes out.


I have been extremely busy latey (yes FlatCokeness), so I'll see what I can come up with.

I got the keys to the new house today and a garage opener.

The garage door opener didn't open the garage door.

The house echoes right now. now. now. now. now.


On my way home from the uniform shop today, I noticed the turnpike entrance was blocked off by two sherriff cars and one city police car. I automatically figured they were after some fugitive. Possibly guarding the entrances to see if the bad guy takes that route?

When I got home I saw there was a brush fire off the turnpike so they weren't allowing people on.

Oh well.


I haven't watched much of the news lately, but I saw it this afternoon and my jaw hit the floor.

My ex boyfriend (Match.Marriott)'s ex-wife was being escorted out of her pharmacy in handcuffs with her new husband and some other people. She's a pharmacist in Orlando. Apparently she/they are being charged with fraudulently filling prescriptions for narcotics, steroids and hormones. Along with insurance fraud and several other indictments. They are in jail without bond, being extradited to New York.

Yikes. She has two kids.

I half feel bad for her. I'm not quite convinced she was doing anything wrong, but who knows.

Then I remembered she wasn't very nice, not even to my daughter.

So whatever, hope you like New York.

haha

I feel awful for her kids though, but they have a great Dad, so they'll be fine.


I can't wait until it's not dark at 6:30 pm anymore. I drive to work in the dark. I come home in the dark. It makes me feel like I need to go right to bed or something. It'll be different when it's still daylight when I get off work.


I still haven't packed much. That's the procrastinator in me.

How do you not be a procrastinator when you've always been one?

Can you change that?


And last... (because I really need to get some things done), should my new neighbors come over and greet me or should I knock on their door? "Hello, it's me, Analyzing Jordan... I'm your new neighbor. Make me something to eat, bring baked goods over... help me rearrange my furniture"